Journal: Microbial Cell Factories

Article Title: In-situ muconic acid extraction reveals sugar consumption bottleneck in a xylose-utilizing Saccharomyces cerevisiae strain

doi: 10.1186/s12934-021-01594-3

Figure Lengend Snippet: Plasmids used and constructed in this study

Article Snippet: pgRNA-uni-hph (p58) , pBR322 ori ( E. coli ) and 2 micron ori ( S. cerevisiae , multi-copy) gRNA plasmid backbone with hph marker , MCB, KU Leuven.

Techniques: Construct, Plasmid Preparation, Amplification, Marker, Sequencing, Expressing

Journal: STAR Protocols

Article Title: Generation and immunofluorescent validation of gene knockouts in adult human colonic organoids using multi-guide RNA CRISPR-Cas9

doi: 10.1016/j.xpro.2022.101978

Figure Lengend Snippet: Western blot validation (A) Western blot of FBXW7 protein showing knockout. (B) FBXW7 protein expression relative to GAPDH (n = 3) ( p = 0.0015).

Article Snippet: FBXW7 multi-gRNA sequences: GCAAGGAATGGTGAAGTTGT GATGAATCGTGTGGTAGAGG AGCAAAAGACGACGAACTGG , Synthego , .

Techniques: Western Blot, Biomarker Discovery, Knock-Out, Expressing

Journal: STAR Protocols

Article Title: Generation and immunofluorescent validation of gene knockouts in adult human colonic organoids using multi-guide RNA CRISPR-Cas9

doi: 10.1016/j.xpro.2022.101978

Figure Lengend Snippet: Immunofluorescent validation Immunofluorescent validation of FBXW7 wild-type and knockout with DAPI (blue), F-actin (red) and FBXW7 (green). Scale bar equals 50 μm.

Article Snippet: FBXW7 multi-gRNA sequences: GCAAGGAATGGTGAAGTTGT GATGAATCGTGTGGTAGAGG AGCAAAAGACGACGAACTGG , Synthego , .

Techniques: Biomarker Discovery, Knock-Out

Journal: STAR Protocols

Article Title: Generation and immunofluorescent validation of gene knockouts in adult human colonic organoids using multi-guide RNA CRISPR-Cas9

doi: 10.1016/j.xpro.2022.101978

Figure Lengend Snippet:

Article Snippet: FBXW7 multi-gRNA sequences: GCAAGGAATGGTGAAGTTGT GATGAATCGTGTGGTAGAGG AGCAAAAGACGACGAACTGG , Synthego , .

Techniques: Recombinant, Software, Cell Culture, Transferring, Membrane, Microscopy, Transfection

Journal: Cell reports

Article Title: High-grade serous ovarian tumor cells modulate NK cell function to create an immune-tolerant microenvironment

doi: 10.1016/j.celrep.2021.109632

Figure Lengend Snippet: HGSC and NK-92 cell lines were cocultured at a ratio of effector (NK-92) to target (HGSC cell line) of 1:1 for 6 h unless otherwise indicated . (A) Frequency of CD9+ NK-92 cells after coculture with and without transwell (left panel). Mean and standard deviations for n = 4. Exemplary 2D flow plots for CD9+ NK-92 cells after coculture (right panel). (B) Extra- and intracellular CD9 protein expression absent from the NK-92 cells and present at high levels in the OVCAR4 cells. (C) Quantitative real-time PCR of FACS-purified CD9+ and CD9− NK-92 cells after coculture with OVCAR4 cells. Copy number (top plots), fold gene expression changes (bottom plots). CD9 were transcripts exclusive to OVCAR4 cells. Controls: CD45 (positive for NK-92, negative for OVCAR4) and E-cadherin (negative for NK-92, positive for OVCAR4). (D) Flow cytometry shows cytochalasin D partially inhibits trogocytosis from HGSC cell lines. (E) Transfer of CD9+ membrane fragments from OVCAR4 cells onto NK-92 cells. Cocultures between OVCAR4 cells pre-stained with fluorescent membrane dye PKH67 and NK-92 cells at different target:effector ratios. PKH67 frequencies (top histograms) and CD9 frequencies (bottom histograms). (F) Microscopy shows trogocytosis. OVCAR4 cells and NK-92 cells stained with PKH67 (green) and PKH26 (red), respectively; cocultured for 3 h; and stained with CD45 and CD9 antibodies. Images (from a Keyence BZ-X800 microscope) for cells grown in monoculture 20× and coculture 60×. NK-92 cells that acquired CD9 from OVCAR4 cells are indicated with white arrows. Images were enhanced for brightness and contrast to optimize the printed image.

Article Snippet: CD9 multi-guide RNA probe2: CUUGGUUUUCAGCUUGUUGU , Synthego , N/A.

Techniques: Expressing, Real-time Polymerase Chain Reaction, Purification, Gene Expression, Flow Cytometry, Membrane, Staining, Microscopy

Journal: Cell reports

Article Title: High-grade serous ovarian tumor cells modulate NK cell function to create an immune-tolerant microenvironment

doi: 10.1016/j.celrep.2021.109632

Figure Lengend Snippet: (A) CD9 expression levels in 11 HGSC and 15 non-HGSC tumor cell lines . (B) Cell lines ranked by level of CD9 expression. Cell lines selected for coculture with NK-92 cells: HGSC (magenta) and non-HGSC with high levels of CD9 (green) and with lower levels of CD9 (yellow). (C) Representative flow plots showing frequency of CD9+ NK-92 cells after coculture with non-HGSC tumor cell lines. (D) Cytochalasin D partially inhibits CD9 trogocytosis from non-HGSC tumor cell lines. (E) CD9 trogocytosis by the NKL cell line and primary NK cells in peripheral blood mononuclear cells (PBMCs).

Article Snippet: CD9 multi-guide RNA probe2: CUUGGUUUUCAGCUUGUUGU , Synthego , N/A.

Techniques: Expressing

Journal: Cell reports

Article Title: High-grade serous ovarian tumor cells modulate NK cell function to create an immune-tolerant microenvironment

doi: 10.1016/j.celrep.2021.109632

Figure Lengend Snippet: NK-92 cells were cocultured with HGSC cell lines (1:1) for 6 h, treated with brefeldin A/monensin and PMA/ionomycin or vehicle, and analyzed with the NK cell antibody panel (K562 cells as positive control) ( ; ). CD9+ and CD9− NK-92 cells were manually gated with CD45+. (A) Frequencies of CD9+ and CD9− NK-92 cells producing intracellular cytokines are indicated. Student’s two-tailed t test (also for B), showing statistically significant differences between CD9+ and CD9− NK-92 cells. *p ≤ 0.01, **p ≤ 0.001, ***p ≤ 0.0001, ****p ≤ 0.00001. (B) Levels of intracellular cytokines produced by CD9+ and CD9− NK-92 cells. CD9+ NK-92 cells produced lower levels of anti-tumor cytokines (see text). (C) Cytotoxicity, measured by the calcein release assay, was suppressed toward HGSC cell lines compared with K562 cells (positive control) . Student’s two-tailed t test (also for D and E). *p ≤ 0.05, **p ≤ 0.01, ***p ≤ 0.001. (D) CD9+ NK-92 cells that underwent FACS after coculture have reduced cytotoxicity for HGSC cells compared with CD9− NK-92 cells. Statistical significance was determined with a two-tailed t test. *p ≤ 0.03, (*) p = 0.06. (E) CD9-blocking antibody significantly increased NK-92 cytotoxicity toward OVCAR4 cells. (F) CD9 CRISPR knockout in OVCAR4 cells significantly increased NK-92 cytotoxicity in coculture. UT, untreated; vehicle, nucleofector solution. Statistical significance was determined with a two-tailed t test. *p ≤ 0.05, **p ≤ 0.01, ***p ≤ 0.001. (A–D) Mean of triplicates and (E and F) mean of quadruplicates with standard deviations.

Article Snippet: CD9 multi-guide RNA probe2: CUUGGUUUUCAGCUUGUUGU , Synthego , N/A.

Techniques: Positive Control, Two Tailed Test, Produced, Release Assay, Blocking Assay, CRISPR, Knock-Out

Journal: Cell reports

Article Title: High-grade serous ovarian tumor cells modulate NK cell function to create an immune-tolerant microenvironment

doi: 10.1016/j.celrep.2021.109632

Figure Lengend Snippet: KEY RESOURCES TABLE

Article Snippet: CD9 multi-guide RNA probe2: CUUGGUUUUCAGCUUGUUGU , Synthego , N/A.

Techniques: Purification, Recombinant, Staining, Blocking Assay, Electron Microscopy, Cell Stimulation, Membrane, Labeling, Conjugation Assay, RNAscope, Isolation, Reverse Transcription, Gene Expression, Gene Knockout, DNA Sequencing, Software, Cytometry, Real-time Polymerase Chain Reaction, Microscopy, Flow Cytometry